resource source identifier pce kdgl addgene (Addgene inc)
Addgene inc is a verified supplier 
92
Structured Review
Addgene inc
resource source identifier pce kdgl addgene
Resource Source Identifier Pce Kdgl Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+pce+kdgl+addgene/pCE-KdGl+(Plasmid+%23154880)/pm37714158-146-2-6
Average 92 stars, based on 4 article reviews
Resource Source Identifier Pce Kdgl Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/resource+source+identifier+pce+kdgl+addgene/pCE-KdGl+(Plasmid+%23154880)/pm37714158-146-2-6
Average 92 stars, based on 4 article reviews
resource source identifier pce kdgl addgene - by Bioz Stars,
2026-10
92/100 stars
Images
Related Articles
Software:Article Title: Generation of a tyrosine hydroxylase-2A-Cre knockin non-human primate model by homology-directed-repair-biased CRISPR genome editing. Article Snippet: Cas9 Nuclease V3 IDT Cat#1081058 Cas9-DN1S Jayavaradhan et al.20 N/A Custom Alt-RTM CRISPR-Cas9 guide RNA IDT N/A Alt-R CRISPR-Cas9 tracrRNA IDT Cat#1072532 (RAD51-134H) Recombinant Human RAD51 Creative Biomart Cat#RAD51-134H Critical commercial assays REPLI-g Single Cell Kit Qiagen Cat#150343 PrimeSTAR Max DNA Polymerase Takara Cat#R045A BigDye Terminator v1.1 cycle sequencing kit Thermo Fisher Scientific Cat#4337449 Deposited data Raw data of WGS This paper DRA013552 and DRA016136 Experimental models: Cell lines CMES40 (No.40) Sasaki et al.44 N/A HEK293T Provided by Dr. Hiroyuki Miyoshi at Keio University N/A TH-1 fibroblasts This paper N/A Th-1 iNSLCs This paper N/A Experimental models: Organisms/strains Marmosets (Callithrix jacchus) RIKEN in-house colony N/A Oligonucleotides TH sgRNA-1: CGCACTGAGTGCCATTGGCT This paper N/A TH sgRNA-2: GAGTGCCATTGGCTAGGTTC This paper N/A TH sgRNA-3: AGTGCCATTGGCTAGGTTCA This paper N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) Addgene Cat#62988 pKI-cjTH-Cre-rfNeo Addgene (deposited) Cat#186248 pKI-cjTH-Cre-Dlox Addgene (deposited) Cat#186249 pCE-hOCT3/4 Addgene Cat#41813 pCE-hSK Addgene Cat#41814 pCE-hUL Addgene Cat#41855 pCE-mp53DD Addgene Cat#41856 pCXWB-EBNA1 Addgene Cat#36724 pCE-K2N Addgene Cat#154879 (Continued on next page) e1 Cell Reports Methods 3, 100590, September 25, 2023 .. REAGENT or |